Perl crawl website jobs

Filter

My recent searches
Filter by:
Budget
to
to
to
Type
Skills
Languages
    Job State
    14,514 perl crawl website jobs found, pricing in USD

    **Summary:** Need a custom perl (Open to PHP, or other language design) program designed that'll act as a shopping cart for my website, with versatile administrative capability. Have several specifications that I need that won't allow me to seek out and purchase a pre-designed package. Several things unique to my company, etc. It's nothing complex

    $316 (Avg Bid)
    $316 Avg Bid
    12 bids

    ...authentication problems with my scripts or perhaps since the dynamic pages are drawing info from an SQL database - maybe its specific to SQL? The Result I'm looking for is a perl script (or other mutually agreeable format). If the script is given the access passwords it should be able to navigate to the page(s) I want and pull the html. Also it should

    $127 (Avg Bid)
    $127 Avg Bid
    6 bids

    ...MUST work without having to change security. MUST WORK with out having to loosen the permissions to file:666 and dir:777, My other webpage based adduser etc... solutions in perl are working fine, there is no reason for this one not to also. 4.) Only one user name has to be entered at a time. Only the user name is required. No password will be entered

    $46 (Avg Bid)
    $46 Avg Bid
    2 bids

    Need help to make this script receive user name from a web page and restore their access. [login to view URL] ## Deliverables Complete source code of all programming work done

    $46 (Avg Bid)
    $46 Avg Bid
    7 bids

    We are currently looking for PHP and Perl programmers who have had working commercial experience specifically related to site tracking, search engines and marketing projects. LONDON AREA ONLY Please send CV and any examples of work to: [login to view URL]@[login to view URL]

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    We are currently looking for PHP and Perl programmers who have had working commercial experience specifically related to site tracking, search engines and marketing projects. Please send CV and any examples of work to: [login to view URL]@[login to view URL]

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    ...designed in perl which has the following features. Members login: one for guest:guest, one for paid members which they will create login:pass. All information for paid members will be stored on file and retrieved when login. No information, no anything, is saved for guest:guest users. When they login to either script, they will be able to use a perl-based

    $40 (Avg Bid)
    $40 Avg Bid
    7 bids

    ...probably a 10 minute job for the right person, but that person is not me. All I need to do is get the dynamic html of a site... thats it. I can do it easily with a browser but my perl script won't yet do the job. The site is https, requires a login and uses cookies/session key. The content is generated from a database (sql?) and is specific to my login. I

    $58 (Avg Bid)
    $58 Avg Bid
    3 bids

    Hi; I need a Perl coder/coders for some MODs I need done to a perl forum script. The actual program is UltraBoard 2000 2.23, which should be fairly generic code for any perl programmer. I can live with most of the out-of-package features, but there are specific mods that I would like. You can get a better idea by checking out my board at: http://207

    $106 (Avg Bid)
    $106 Avg Bid
    2 bids

    Im I need of a very basic Web based Project Managment Application. This must be completed using Perl or PHP with MySQL. Required features: Admin page: Allows you to view, create, delete projects. (When creating a new project, a new directory must be made in the root web dir and all files for project placed in the newly created dir. When deleting a project

    $121 (Avg Bid)
    $121 Avg Bid
    10 bids

    Send / Recieve mail directly from AOL servers using perl and linux. I provide Example Files: [login to view URL] contains 10 aol usernames (ScreenNames) one per line delimited by newlines. [login to view URL] contains a 300 Char Text Message. you will create: [login to view URL] a simple perl script that is easy to read and modify sendaolmail contains the following

    $100 - $500
    $100 - $500
    0 bids

    Hello, I wish to display the filesize next to each file printed in the array below Please note - the 2 array symbols are now an astrisk to allow me to send this email here at rent a coder.... I tried $ENV{'CONTENT_LENGTH'}hoping to do just that but had no luck? I would be gratefull if one of you pro's could help me add this tid bit to my view sub below, so that I may learn what I wa...

    $15 (Avg Bid)
    $15 Avg Bid
    3 bids

    Hello! I wish to display the filesize next to each file printed in the array below Please note - the 2 array symbols are now an astrisk to allow me to send this email here at rent a coder.... I tried $ENV{'CONTENT_LENGTH'}hoping to do just that but had no luck? I would be gratefull if one of you pro's could help me add this tid bit to my view sub below, so that I may learn what I wa...

    max $5
    max $5
    0 bids

    Hello, We are currently looking for Perl programmers to help develop open source and commercial CGI products. You must have reasonable knowledge in any of the following areas: Perl Javascript Advanced HTML We would prefer it if you had previous experience at programming full products but it is not required. Programmers would benefit from a profit share

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    a script in either php or perl with mysql that's a clone of [login to view URL] with all thier features ## Deliverables Complete source code of all programming work done proof that it works

    $1640 (Avg Bid)
    $1640 Avg Bid
    5 bids

    I need a script that will pull email addresses and names from a mysql file and mass mail to 1000's of people which works in the backgroud with a confirmation after the mailing to let me know that it is done ## Deliverables The code must include a htlp form in which to enter the subject, body and from email address beofre sending the mailing. The mysql file is already in use and this script...

    $68 (Avg Bid)
    $68 Avg Bid
    5 bids

    Hello, I am new at PERL and over the last month have produced a script to help me organize a single users data. Two things still need to be fixed. 1. The script is processing "" semi quotes and such entered in on the edit form. (This is currently hardcoded and simply opens a text file and overwrites it) How can I prevent this from occuring? 2. My showdates

    $21 (Avg Bid)
    $21 Avg Bid
    2 bids

    I need a program that starts with two parents parent1:TCGAGTGCCTCGATGACTAT parent2:GTTTTGGCAACAATGTAGGG This program should use a random method of choosing between crossover,mutation, and reporduction. Reproduction just simply compies the genetic code to the two children. Mutation basically mutates the genes and crossover, take half the genes, splits them and then combines them with the other chil...

    $144 (Avg Bid)
    $144 Avg Bid
    4 bids

    I have a perl script that I bought (Over a year ago.) to do a thumbnail gallery and included in the program was a picture thumbnailer. I need to get the picture thumbnailer setup as a separate program that I can use on other websites. What it does? I place any number of full sized pictures into a folder on the server. The cgi script goes out and grabs

    $25 (Avg Bid)
    $25 Avg Bid
    1 bids

    ...conversion of two C programs into two Perl based CGI scripts which will be invoked by either the HTTP “get” or “post” method. The C programs have two or so other C programs (and a header file) that they are dependant on. A number of the functions in these supporting C programs also need to converted into the appropriate Perl functions/modules to provide exactly

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    Need to transfer a unix - script to an win2000 machine. It`s an upload script. ## Deliverables The script must be checked - and then changed to work on a win2000 server. 1 function must be removed from the script. Please contact me for a copy of the file. ## Deadline information Only 320 lines of code for review. i think for an professional should be 10 min. work.

    $87 (Avg Bid)
    $87 Avg Bid
    8 bids

    Possible week long training in London. Please e-mail with day rates etc.

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    ...like to automate this task by sending our own spider to the link provided and check the relevance of the page. If not found on that page or in the tags, it must be able to crawl through the site and find something relevant to what they've entered. An exact match is not required as long as something similar is found. If it is determined that the keyword

    $820 (Avg Bid)
    $820 Avg Bid
    1 bids

    Wanted hardcore serious experieced PERL programmers who should possess good OOP knowledge. Preference would be given to the people familiar with some of the important PERL modules. CGI programming knowledge is a plus. Contact without CV mentioning total years of experience and nationality. Location is UK/EU. Foreign nationals [login to view URL] azsx109@onebox

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    We require a freelance programmer to make small modifications to an ‘off the shelf’ perl script. Working remotely, in your own time our requirements are as follows: 1. Once the customer has placed the product(s) in to the basket, the final page, which collects the customer information, will be located on a remote secure server ([login to view URL]) We

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    [login to view URL]

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    Hi, I need a perl cgi script made. Basically, the perl script will verify a list of email addresses, and save the valid ones to a text file. I have found a perl module at [login to view URL] that I think does this. What I am wanting is for someone to take this module, or make their own, and provide to me a fully-functioning script, ready

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    We need to have a script built that will take information supplied in a form and then build a HTML page automatically into the correct directory structure on our servers. Would be interested in hearing from anyone that thinks they can do this. I very good example is NetCard located at [login to view URL]

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    We are looking for a "low cost" CGI/Perl programmer to do two projects which may involve hacking existing scripts. Our budget is very limited, however, we are prepared to off-set the difference with advertising on our site including free job/project referrals. [login to view URL] will soon begin helping businesses and individuals find, compare and select web

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    ...websites. The script/program will be based on a Unix server, and needs to have a page available to specify URL's and keywords (actually company names). Then the application crawl the sites (either continuously or daily, whatever can be achieved). Example URL's are: [login to view URL] [login to view URL] http://www

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    ...Internet Consultancy specialising in small to large company Web Sites, due to expansion are seeking an experienced Lead/Senior Programmer to compliment our existing team. 2 x Perl, PHP, MYSQL developers with experience for programming for database dynamic driven E-commerce Web Sites. One more senior 3 years + and one junior with System Administration

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    Hi We have a requirement for a perl contrator to do some 'polishing' to existing code and to create some new modules. This person needs to based in the UK, either in Hampshire or Berkshire. The following skills are ideal: Perl, Unix, CGI Please drop me a mail or call for a chat on: 01256 411344 07989 140124 Thanks! Mark Hughes [login to view URL]

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    We require an individual with good, quality experience and skills working with perl and the CGI environment. In particular a full understanding of mod_perl and related performance issues and techniques. Work will involve design, migration and tuning of existing and new systems.

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    Hi We urgently require a experienced Perl programmer, to build a relatively simple Content Management System (mostly news articles) and a user database (access by username and password). We need someone to come in for a brief Wednesday 20th AM !! Please call JM Littman 0207 596 6700

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    I've been asked to develop the front end on a messaging site that will be wap enabled. If I'm going to take it on I need a good perl person to work with. You will be experienced with URLs of database driven sites using PHP/perl in your portfolio. If you know XML too I'll be particularly interested. For details of the job send in your skillset, URLs

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    I'm looking for a freelance programmer to write me a form and a script. For an idea of what I'd like to achieve, take a look at the following page on [login to view URL] by phillip greenspun; [login to view URL] Scroll down the page a bit and you can see the readers comments. Phillip gives away the software that runs his site for free, but all I want is to gather comments, and I don&...

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    Hello We’re in searching of a highly experienced web crawling expert that can crawl, develop and maintain a automatized web crawling system. The system should be able to crawling different sources around the web based on defined search queries and create a well combined and aggregated result. Experienced in data visualization by visualize the result

    $4 / hr (Avg Bid)
    $4 / hr Avg Bid
    4 bids

    Như title, mình cần 1 bạn viết game như [login to view URL] Yêu cầu: + Có giao diện (như tiki, hoặc tùy chỉnh bắt mắt thì tốt) + Có tương tác API cho ra kết quả (random hoặc control bằng database càng tốt) + Viết bằng asp.net MVC

    $30 - $250
    $30 - $250
    0 bids

    Hello We are trying to develop a Managed Hosting platform and are looking for a Development partner who knows PHP, Python / Perl and know's how to configure Web servers like Nginx, Apache, Litespeed. Let me know if you wish to work with us as a Development Partner. Note: Looking for an Individual Freelancer, Not an agency! Thank you!

    $125 (Avg Bid)
    $125 Avg Bid
    2 bids

    ...(9) Only English language websites allowed. (10) Google should be allowed to crawl the backlink page means Backlink should be indexable, not disawoved in the [login to view URL] file. (11) Only links from relevant sites, related category, and related niche will be accepted. My website is in the technology category. (12) Link pages and our text links must be visible

    $155 (Avg Bid)
    $155 Avg Bid
    1 bids

    Need to detect and crawl non responsive websites registered through internet. Is it possible?

    $28 (Avg Bid)
    $28 Avg Bid
    3 bids

    I have a csv file with about 100k website urls and i need someone to web crawl them or emails, im looking to do 10k at a time or less. You must have the ability to bulk extract data rom websites, all we are needing are the emails to build a email list, project should take a few hours per batch.

    $7 / hr (Avg Bid)
    $7 / hr Avg Bid
    16 bids

    Need to detect and crawl non responsive websites registered through internet. Is it possible?

    $70 (Avg Bid)
    $70 Avg Bid
    5 bids

    ...do follow back links to my shopping website as follows, 15 - Social Bookmarking 15 - Video Links 15 - Directory links 20 - Indian Blog Comments 15 - Profile creation Links 20 - Indian Forum links Do not use any any black hat technique, All links should be permanent and search engines should to able to crawl and index it. I will give anchor

    $4 / hr (Avg Bid)
    $4 / hr Avg Bid
    10 bids

    Here is the script I want you to write : comma delaminated output Capture text in single line Add hash to array Add to csv output

    $25 (Avg Bid)
    $25 Avg Bid
    1 bids

    create endpoint/API to filter notifications based on Read/unread, type, date range. we already have an api to GET all Notifications. but no api for filtering PERL, MONGO Get ready with team viewer plz

    $30 - $250
    $30 - $250
    0 bids

    hey ! i have a project of perl programming used in bioinformatics. For this assignment you need to provide the following things: A rough outline that clearly shows how the problem can be broken down into subproblems. Pseudo code that describes how the problem can be implemented. A Perl program that implements the program according to the instructions

    $78 (Avg Bid)
    $78 Avg Bid
    5 bids

    Нужен кодер знающий XFilesharing Pro (Perl), для разных доработок на данном скрипте. Оптала договорная.

    $30 / hr (Avg Bid)
    $30 / hr Avg Bid
    1 bids

    Requiero programadores para darle mantenimiento y desarrollo de nuevas funcionalidades a un ERP desarrollado en Linux, Perl y MYSQL. El trabajo es por objetivos y completamente freelance la forma de pago a convenir. Se busca en primera instancia el mantenimiento y desarrollo de nuevas funcionalidades. En segunda etapa el mejoramiento de la UI y finalmente

    $9 / hr (Avg Bid)
    $9 / hr Avg Bid
    8 bids

    Consolidating these WP sites: [login to view URL], [login to view URL], [login to view URL] ... into this domain [login to view URL], [login to view URL], [login to view URL] 1. Backup 2. Migrate 3. Setup 301 redirects (regex) 4. Site crawl to ensure paths are working with no 404s

    $125 (Avg Bid)
    $125 Avg Bid
    39 bids