Web design classes children jobs

Filter

My recent searches
Filter by:
Budget
to
to
to
Type
Skills
Languages
    Job State
    60,502 web design classes children jobs found, pricing in USD

    I need to write a small program (in C) to sort a list of 10 numbers provided in a file called [login to view URL] The program should accept a command line parameter which will determine if the number should be sorted in ascending or descending order. Next, I ned to show the use of polymorphism with two classes, an invoice class and a sales order class. ## Deliverables Complete source code of al...

    $6 (Avg Bid)
    $6 Avg Bid
    2 bids

    Need two gradebook programs written in "C". One will grade an individual classroom of 12 students, the other must grade 3 separate classes of with 12 students each. Program will get its data from keyboard input. Must use an array of structs. 1st function will load FIRSTNAME, LASTNAME and exam grades for 6 exams. 2nd function will calculate the average grade for each student as well as th...

    $48 (Avg Bid)
    $48 Avg Bid
    9 bids

    Imagine a publishing company that markets both book and audiocassette versions of its works. Create a class Publication (base class) that sotres the title (a string) and price (type float) of a publication. Drom this class derive two classes: Book, which adds a page count (type int); and Tape, which adds playing time in minutes (type float). Each of these three classes should have a getData() func...

    $36 (Avg Bid)
    $36 Avg Bid
    5 bids

    I need a program that starts with two parents parent1:TCGAGTGCCTCGATGACTAT parent2:GTTTTGGCAACAATGTAGGG This program should use a random method of choosing between crossover,mutation, and reporduction. Reproduction just simply compies the genetic code to the two children. Mutation basically mutates the genes and crossover, take half the genes, splits them and then combines them with the other chil...

    $144 (Avg Bid)
    $144 Avg Bid
    4 bids

    I need a simple class that can print a .bmp to a printer. The class MUST NOT use ANY MFC features or classes or ANYTHING!(ie no CBitmap). I cannot stress this enough I have tried things like this in the past any everyone thinks that a little MFC is OK. NO! None!. That said, the class should have a function that will ask for the Bitmap's file location and maybe some printing dimentions and loc...

    $18 (Avg Bid)
    $18 Avg Bid
    5 bids

    I need tutoring for C++ in Classes, Mutator member functions, Helper functions and Objects. This is for a class I am presently taking in college. If you are not available, maybe you might know of someone that can. My Phone number is aa2815979091zz ## Deliverables Someone that is fairly knowledgeable in C++

    $30 - $5000
    $30 - $5000
    0 bids

    Hi, I need a logo for my company, Websketching. We develop web sites and will soon offer HTML and web development training classes. I like logos in the style of ebay and macromedia. I envision something clean, probably only 2 or 3 colors and something that would look good on business cards, etc. I was thinking that I may need something with the whole "Websketching" named spelled out for ...

    $61 (Avg Bid)
    $61 Avg Bid
    30 bids
    classes Ended

    Two-dimensional arrays are a component of many programs. The goal of this exercise is to simplify the development of such programs by encapsulating the concept of a two-dimensional array (of integers) into a convenient C++ class. Your job is to implement this class. (Attachment includes definition of class) Save the file as twoDimArray.cpp. Note that your constructor must dynamically allocate an o...

    $22 (Avg Bid)
    $22 Avg Bid
    1 bids

    Two-dimensional arrays are a component of many programs. The goal of this exercise is to simplify the development of such programs by encapsulating the concept of a two-dimensional array (of integers) into a convenient C++ class. Your job is to implement this class. (Attachment includes definition of class) Save the file as twoDimArray.cpp. Note that your constructor must dynamically allocate an o...

    $25 (Avg Bid)
    $25 Avg Bid
    2 bids

    This app is completed with minor bits and pieces currently being updated. Its a prog for looking after children in care A Social Worker needs to be kept uptodate with a childs progress whilst in a care facility. The social worker will be updated daily via a server update which is backed up by another application located at the childs care home. I need the app to be able to 'back' itself ...

    PHP
    $69 (Avg Bid)
    $69 Avg Bid
    9 bids

    Register Students Set up classes, lessons and other activities and register students. Charge Registration Fees . See enrollment numbers for current, completed or future classes. Alerts inform when classes are full, wait lists or requirements exist. Mailing Lists & Reports Create lists of Inquiries, Active and Inactive Students. Print pre-sorted address labels with or without bar codes. Send le...

    $6148 (Avg Bid)
    $6148 Avg Bid
    27 bids

    i have already programed blackjack but i have used functions and not incorporated the code into classes what i need is the console code to be converted into classes ## Deliverables the current code written into classes a working program in classes a betting function added to the code full documentation of proceedure in changing code into functions. ## Deadline information quick job needed b...

    $25 (Avg Bid)
    $25 Avg Bid
    6 bids

    We are looking for freelance teams (2-3 people) in the London area who can build sites targeted at children from scratch. Skillsets include project management, games development, animation, flash/shockwave programming, photoshop, HTML, database integration. No agencies, please, but freelancers who can work together on new and exciting projects should get together and send us your group details. i...

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    This project aims at developing a primitive application for a library system. The data for the system is stored in a file books.txt. You are to write three java classes, namely; Book, Library and TestLibrary Here is a sample output: *********************************** Welcome to the Virtual Library ********************************** Available Services: 1 Add a book. 2 Search a book ...

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    I Have Right Now A Text Based Adventure Game But Need A Way To Move Through An Array Must Be Compatible With Dev C++ Version 4 ## Deliverables It Must Use Keyboard Input To Move Through The Array And Must Be Text Based Also It Must Not Allow The Man To Move Of The Edge Of The Map Prefer Being Done With Out Classes But Can If You Want To

    $5 (Avg Bid)
    $5 Avg Bid
    2 bids

    Please read the contents of the zip attached file. Name your price so we can get this done. ## Deliverables To be done in Turbo C++ (DOS), make sure that all your classes & ADT's are in your own h file. Also try to make it look flashy. ## Deadline information The sooner the better.

    $33 (Avg Bid)
    $33 Avg Bid
    5 bids

    The primary role of this job is to develop sophisticated Flash programs for use in projects on behalf of corporate clients and for internal projects. The successful applicant will be contributing to the development of web-based interactive cartonns as part of our on-line educational project. to see examples of the sort of work involved, go to [login to view URL] He or she will also be expected t...

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    I am painting and creating illustrations with Adobe Illustrator and Adobe Photoshop for children’s books. (I already have over 40 illustrations for sale like esp.-files) and I am looking for someone how is interested to work with me. See samples: [login to view URL] S.P. I am also a graphic designer and I could design the book for you to be ready for printing. My e-mail: noushastykova22@[login to...

    $200 - $300
    Sealed
    $200 - $300
    0 bids

    No flash experience necessary. Although it'd be useful, we can train you up to scratch within a week. We're looking for somebody to help with the design and creation of interactive Flash 5 games aimed at young children at our offices in Leighton Buzzard (in Bedfordshire, just south of Milton Keynes). You need to be computer savvy, have experience of computer graphics (maybe website desi...

    $200 - $300
    Sealed
    $200 - $300
    0 bids
    Fazer um desenho 5 days left

    Desenhar uma tatuagem, com classes de rpg.

    $46 (Avg Bid)
    $46 Avg Bid
    8 bids

    Pretende-se que seja desenvolvida uma pequena class em PHP que contenha os métodos básicos para interagir com Binance e Coinbase PRO através das respetivas API. Assim, estas classes deverão ter métodos que permitam: - Autenticação; - Consulta dos preços atuais para as várias moedas negociadas (último preço de venda e prim...

    PHP
    $200 (Avg Bid)
    $200 Avg Bid
    5 bids

    Job apenas para Copywriters Criação de roteiro para VT de um minuto de Clínica Dentária voltada para público de 40 anos ou mais, das classes C, D e E de Brasília e Goiânia. O texto deverá ser incisivo ao motivar a pessoa a agendar seu horário para avaliação odontológica mas sem perder a classe. O ator do sexo masc...

    $441 (Avg Bid)
    $441 Avg Bid
    11 bids

    Hello, I have a job that I need an animated video creation. We are a school of entrepreneurship for children, on the site is [login to view URL] This is an example of how you would like the video: [login to view URL]

    $187 (Avg Bid)
    $187 Avg Bid
    13 bids

    Kinderise adalah sebuah parents & children center dengan multi-concept yang berfokus pada pengembangan karakteristik anak dan melatih imajinasi anak, dengan metode pendekatan untuk anak 1-5 tahun. Tujuan kami adalah menjadi one stop place untuk parents & children yang membutuhkan tempat untuk mendukung tumbuh kembang anak sesuai dengan tahapan usia-nya.

    $22 (Avg Bid)
    $22 Avg Bid
    5 bids

    J'ai un site internet des supports de cours en applications et livres électroniques pour huit classes. J'aimerais avoir un compteur de téléchargement pour les fichiers de chaque classe à afficher sur la page de chaque classe. Et un compteur de téléchargement de tous les fichiers sur la page d’accueil. Le site est hébergé chez...

    $31 (Avg Bid)
    $31 Avg Bid
    13 bids

    Notre école a investi dans un code source d'une solution de création/gestion de tests/examens en ligne. Nous souhaiterions modifier le code pour une utilisation répondant à nos besoins et pour l'optimiser. a) Permettre la création de comptes élèves directement par l'enseignant (avec renseignement id et mot de passe). Supprimer l'...

    $573 (Avg Bid)
    $573 Avg Bid
    14 bids

    O Pralimao foi desenvolvido para atender a necessidade latende de usar o limão na mesa, sem o contato com a pele. É uma megatendência de mercado, design premiado, patenteado, garantido, material durável, fabricado em escala industrial, preço acessível, atende a todas as classes, idades e sexo... O produto personalizado coloca a marca da empresa na mesa do...

    $390 (Avg Bid)
    $390 Avg Bid
    5 bids

    Nossa empresa tem um sistema em JAVA muito grande mas que ainda não tem testes automatizados. Quero começar pelo desenvolvimento de testes funcionais, então quando o projeto for construído cada uma das páginas do sistema precisará ter suas principais funcionalidades testadas. Atualmente o sistema tem aproximadamente 250 XHTMls com 180k linhas de có...

    $537 (Avg Bid)
    $537 Avg Bid
    3 bids

    Want to make an avant-garde design and modern curtain bra. The idea is to maintain the spiral mechanism, as expected an elegant and simple design. The objective is to make a spiral curtain fastener, which can introduce interior designs for children, offices, restaurants, schools, etc. Quiero hacer un diseño vanguardista y moderno sujetador de cortinas. La idea es mantener el mecanismo de e...

    $66 (Avg Bid)
    $66 Avg Bid
    6 bids

    (Scroll down for details in English) El rediseño de este sitio web: [login to view URL] Necesitamos un sitio web comercial entregado 100% administrable por nuestro equipo. Incluyendo blog y sistema automatizado para captación de base de datos. Eso incluye plan y administración de email marketing junto con sus respectivos thank you page (cuando se suscriben) y el email de ...

    $431 (Avg Bid)
    $431 Avg Bid
    52 bids

    Hi! I need some freelancer to design the toys packing for children, with 70pcs and it's have to finish at the end of June. Thanks so much. Mình cần một số bạn để thiết kế bao bì sản phẩm đồ chơi cho trẻ em. Nó là các hộp để đựng đóng gói những đồ chơi cho các bé. Mình cần làm số lượng 70 bộ vào cuối th&aacut...

    $1825 (Avg Bid)
    $1825 Avg Bid
    5 bids

    Que tal chic@s como están?, mi nombre es Gerardo Salcedo Tengo 28 años de edad, vivo en la ciudad de Puerto Vallarta, Jalisco, sí alguno tiene curiosidad puede buscar en google y seguro le dan ganas de visitarme..., Soy padre de 3 hermosos hijos que son mi vida, soy CEO de: JSP Medios es una empresa de comunicación liderado por profesionales que conforman un equipo multid...

    $39 / hr (Avg Bid)
    $39 / hr Avg Bid
    12 bids

    Procuro programador PHP para desenvolver as classes para integração com o Moloni API Apenas procuro Programadores residentes em Portugal. [login to view URL]

    $227 (Avg Bid)
    $227 Avg Bid
    7 bids

    Verkauft werden Wäsche- und Strumpfwaren zu einem guten Preis-Leistungsverhältnis. Es handelt sich um Basic-Modelle, vor allem Eigenmarken für Damen, Herren und Kinder. Der Name soll kurz, einfach und leicht verständlich sein. Er sollte international verwendbar oder ein Phantasie-Name [login to view URL] passendes Logo wird benötigt. Der Shopname sollte auch als Markenname...

    $455 (Avg Bid)
    Guaranteed
    $455
    211 entries

    Criação de um pequeno e-commerce, o trabalho é acadêmico, devendo ter somente as classes de domínio Usuário - que será usuário comum e adm, Produto, Carrinho de Compra, Pedido. Deve ser criado um crud para Usuario , um para Produto, e um para Carrinho de Compra o desenvolvimento do projeto deve ser feito com tecnologia Java EE, utilizando padr...

    $189 (Avg Bid)
    $189 Avg Bid
    6 bids

    Create website for children amusement industry include 5 pages,email, and online chat tool

    $164 (Avg Bid)
    $164 Avg Bid
    44 bids
    Trophy icon Logo dental orthodontic Ended

    I am a young, fast-growing business creator who is looking for motivated designers for an extraordinary project. The purpose of this contest is to create the logo of my orthodontic practice (dental office that makes appliances for children and adults). The firm's values ​​are: modernity, size, future, quality, high-tech, professionalism, rigor The name of my company is CDV Indication: The &q...

    $55 (Avg Bid)
    Guaranteed
    $55
    55 entries

    La tienda se llama: The Mshop necesitamos algunos diseños de logotipos para nuestra tienda; los cuales son dos logos: The Mshop y The Mshop USA. Es una tienda general de productos es decir tiene una multi diversidad de productos desde juguetes para niños hasta utilidades para el hogar. Nos gustaría algo moderno, representativo, creativo y facil de recordar el logotipo de la ti...

    $54 (Avg Bid)
    Guaranteed
    $54
    106 entries

    Olá amigos e amigas desenvolvedores! Procuro quem já tenha experiência no assunto ou até mesmo códigos prontos com API's de Gateways de Pagamento como: PagSeguro, MercadoPago, PayPal, WireCard, entre outros. Se você possui experiência com desenvolvimento Gateways de Pagamento, mesmo que seja apenas 1 ou 2, por favor entre em contato, pois muito p...

    $352 (Avg Bid)
    $352 Avg Bid
    8 bids

    Besoin locuteurs natifs de Français-Canadien pour un projet d’enregistrement vocal ! Projet d’enregistrement vocal en français canadien Bonjour! Êtes-vous curieux de savoir comment la technologie de réponse vocale interactive est développée ? Seriez-vous intéressé à participer au développement et à l'am&e...

    $19 / hr (Avg Bid)
    $19 / hr Avg Bid
    20 bids

    -Diseño de los logotipos (2) -DIseño de imagen de las escuelas (CD, Tarjetas, Logo, Hoja membretada, Playera, Calendario) -Diferentes formatos (Contraste, blanco y negro, colores) -Originalidad de las propuestas -Se debe garantizar que no se propuestas generadas de sistemas automáticos -Se pone el nombre en inglés de niños solo para entender el concepto (El ...

    $215 (Avg Bid)
    Guaranteed
    $215
    143 entries

    ممكن تعملي تطبيق ايفون واندرويد React Native الموقع و api جاهز فكرة التطبيق اعلانات مبوبه عرض التخفيضات والعروض ترجمة الغة الهند IPhone और Android के संभावित अनुप्रयोग प्रतिक्रियाशील मूलनिवासी साइट और एपीआई तैयार हैं आवेदन वर्गीकृत विज्ञापनों का विचार छूट और प्रस्ताव प्रदान करता है ترجمة English Encrypal application Epone and IDROET REATCT NATIVE Site and API Ready Application Application Cla...

    $1000 (Avg Bid)
    $1000 Avg Bid
    1 bids

    Je suis un jeune créateur d'une entreprise en pleine expansion qui recherche des designers motivés pour un projet hors norme. Ce concours a pour but de réaliser le logo de mon cabinet d'orthodontie ( cabinet dentaire qui réalise les appareils pour redresser les dents des enfants et des adultes). Les valeurs du cabinet sont: modernité, grandeur, futur,...

    $22 (Avg Bid)
    Guaranteed Sealed
    $22
    7 entries

    O meu projeto é o seguinte: quero mesclar duas versões de muonline, a 97d e a 99b. mas porque eu quero? Porque a 97d nao suporta mais que os itens classicos e eu quero adicionar itens novos afim de uma renda extra, porém quero deixar a interface igual ou parecida de 97d com as mesmas classes, com as quest originais, pvp(sistema de duelo) igual a 97d, ou seja um downgrade apena...

    $100 - $135
    $100 - $135
    0 bids

    Estou a procura de desenvolvedor de Plugin para Servidor Spigot Minecraft Somos um servidor rpg, e tenho algumas ideias que preciso que sejam aplicadas para plugin. É Necessario um pouco de conhecimento sobre o jogo e como ele funciona para participar do projeto Servidor de Minecraft do Grupo PPA 200k Membros - Servidor RPG (X) - Sistemas de Raças (X) - Sistema de Classes (X) - Sis...

    $165 (Avg Bid)
    $165 Avg Bid
    4 bids

    maximo climatização é uma empresa que presta serviços de instalação, manutenção corretiva e preventiva e higienização de ar [login to view URL] mostrar a importância de um bom profissional para efetuar esses serviços e o quanto é importante manutenção desses aparelhos para uma longa vida &uacut...

    $44 (Avg Bid)
    $44 Avg Bid
    8 bids

    Bom dia, Possuo uma agência de marketing digital e estou em busca de um profissional que cuide do conteúdo para o blog dos meus clientes. Iniciei a agência recentemente, então até o momento preciso de 4 redações semanais com mil palavras para um blog de Odontologia de uma clínica que deseja se tornar referência na região da Vila M...

    $98 (Avg Bid)
    $98 Avg Bid
    3 bids

    Ich benötige eine gemalte Schnee- Weihnachtslandschaft im Hochformat 50x75 cm. Darauf sollte folgendes abgebildet sein: Schneebedeckte Berge, ein paar Häuser, eine Kirche, eine Brücke über einem Fluss, ein paar Kinder, die Schlittschuhe laufen, ein Schlitten mit zwei Pferden, ein beleuchteter Tannenbaum. Das Bild sollte in warmen Farben gemalt werden, ähnlich der Schneelan...

    $560 (Avg Bid)
    Featured
    $560 Avg Bid
    25 bids

    Spanish lessons in Lima. I’m a native Peruvian Qualified Spanish Teacher with 11 years of experience teaching Spanish language for all levels in private classes. I also offer Spanish classes of conversation, grammar. I concentrate on the skill areas you need the most. I teach all the levels and I can go to your home, office, or cafe. The classes include all aspects of the Spanish language wi...

    $19 / hr (Avg Bid)
    $19 / hr Avg Bid
    1 bids

    Hello. I need a plugin for my Wordpress and Woocommece store for my website (I am using DIVI theme). I make football and handball t-shirts, customized with the name and player's number. This is currently done by phone or email but it is tedious work. I need a plugin where the visitor can choose a tshirt design, colour, write the name and player's number, add more players (size, name and ...

    $176 (Avg Bid)
    $176 Avg Bid
    11 bids