Biopython fastq to fasta jobs
Hello - help need with Biopython Bioconductor Blast . Few tutor hours per week I guess. More in PM> chance for future opportunity.
Hello All, We need a skilled person in : Genome and disease pattern research, alignment, DNA research. Needed skills in : R> BLAST/FASTA > BioPython, online knowledge need in statistics too. Happy bidding
Hello all, Need some help with pattern recognition, prediction, pattern finding, and FASTA database, comparison genetics maybe. More in PM. Thanks
ask for ID search data file according to ID save results records in file corresponding to that id Do alignment using Biopython library and save the alignment results in different file. Do tree construction using records file and save the results into a file. Show alignment and/or tree results if requested from user. And provide the ability to save the results in a file.
Please see attached questions and let me know if you can be of assistance. I am working in python 3.4.1
Hello, I have a project that I have to do and so far I have done most of it, but I need the last step and I do not have time. The project is: I have a fasta file with dna sequences and a pattern that match in certain places. I need to reverse complementary sequences and to print the output like: for every match on the original sequence I need to indicate the start and the end of the match, and if the nucleotide matches the sequence I need to print "." instead of the nucleotide. Else, print the nucleotide. If the match is on the complementary sequence I need to do the same steps and print the motif under the sequence. Contact me if you think that you can do it. I think that it is not so complicated, but I do not have time to ...
...follow-up project to the project posted here: https://www.freelancer.com/projects/Python-Perl/repeat-finding-script.html 1. Make the existing repeat finding script work for fasta and gff3 files from other genome projects (a sample of several is attached). The main issues here is that some of these have extra white space, have comments lines starting with #, and have no introns annotated. Missing intron annotations can be inferred by exon positions and I already have a script that can add these missing intron annotations ( ) 2. Using the attached Bac and Fosmid gff3 files, perform the same analysis as in the original project. The challenge here is that these gff3 files simple refer to areas of the original fasta file. So both these
...through a large text document for repeats at specified intervals. The text document is a 600mb FASTA file. A GFF3 document contains annotations that will direct us where we need to search for the repeatsin the FASTA file. The GFF3 document is a tab delineated file. We will use certain columns in the GFF3 file to direct the search in the fasta file. Statistics will be generated based on the results of the search. More Detail: Every line of the fasta file starts with >[name] Example: >scaffold5.1|size591573 After that is a carriage return and a long series of the following five characters A, G, T, C, N The GFF3 file refers to character positions in the string of A, T, G, C, and N in the FASTA file. Example: scaffol...
Biopython/python project Pipeline: Basic Python File Manipulation and BioPython: Seq Object (15 Marks) A DNA sequence has been provided in a file called nucleotide_sequence.txt. a) Open and read the contents of the text files. Print this sequence to the screen. 3 Marks b) Create a DNA Seq object using the sequence that was read from the file in part a. 4 Marks c) Translate this nucleotide sequence to a protein sequence called protein_sequence. 8 Marks BioPython: BLAST Record Manipulation and Visualisation The sequence from Q1 must be identified as follows (A BLAST UML diagram has been provided for your reference): (55 marks) a) Run a BLAST on the unidentified protein sequence and save the results as an xml file called betp.xml. 5 Marks b)...
...the FASTA sequence for the molecules referenced. (See the '##FASTA' directive in the specification.) Within the feature table another column of note is the 9th, where we can store any key=value pairs relevant to that row's feature such as ID, Ontology_term or Note. Your task is to write a GFF3 feature exporter. A user should be able to run your script like this: $ /path/to/ gene ID YAR003W There are 4 arguments here that correspond to values in the GFF3 columns. In this case, your script should read the path to a GFF3 file, find any gene (column 3) which has an ID=YAR003W (column 9). When it finds this, it should use the coordinates for that feature (columns 4, 5 and 7) and the FASTA sequence a...
...the FASTA sequence for the molecules referenced. (See the '##FASTA' directive in the specification.) Within the feature table another column of note is the 9th, where we can store any key=value pairs relevant to that row's feature such as ID, Ontology_term or Note. Your task is to write a GFF3 feature exporter. A user should be able to run your script like this: $ /path/to/ gene ID YAR003W There are 4 arguments here that correspond to values in the GFF3 columns. In this case, your script should read the path to a GFF3 file, find any gene (column 3) which has an ID=YAR003W (column 9). When it finds this, it should use the coordinates for that feature (columns 4, 5 and 7) and the FASTA sequence a...
...option to call that driver. The app should work anywhere in Tanzania especially Dar es salaam. This app will be completely free - there are no extra call charges, and no charges for results. The user can also enter their location if they want to call a taxi from a different city. Option 2 (Call A Bajaj) We want simple and quick app that determines your location and provides a list of ten local bajaj drivers. Clicking on any bajaj driver in that list will immediately show bajaj drivers customer ratings, bajaj number, picture of the bajaj and option to call that driver. The app should work anywhere in Tanzania especially Dar es salaam. This app will be completely free - there are no extra call charges, and no charges for results. The user can also enter their loca...
MSAview: Tool is an alignment viewer. It takes two files (Alignment (In FASTA format and Reference Structure (in PDB format)) as an input and highlight distant interaction. Related to this project the required task include: Attachment File include the current design of MSAview. a) User interface optimization (Customization of Tables-1) b) Represent Distant Interaction as Nodes (Replace Table-2 by Graphical Representation),
MSAview: Tool is an alignment viewer. It takes two files (Alignment (In FASTA format and Reference Structure (in PDB format)) as an input and highlight distant interaction. Related to this project the required task include: Attachment File include the current design of MSAview. a) User interface optimization (Customization of Tables-1) b) Represent Distant Interaction as Nodes (Replace Table-2 by Graphical Representation),
...Eulerian Path Problem using SBH. Here is a sequence that needs to be saved as : AGTCCAAAATAAGATAATATATAGAAAGGTTAGAGGAGCTGTACCCGACCTCCTAAATCTAAACACTAAATAAATATTTG TTGCTATTATCCACAATCAACTTGGGATTTGATGTTGCCATAGCAAATGTTGAATAATACACAAAGCAGCATGGCTTTCA TTCTATCTTGATTCTTTATTCTCTTGTTACTGATAAGACT With this sequence, I need you to create a program that takes in a FASTA file, like the one above, and finds all of the edges that corresponds the that sequence, and print it out in another FASTA file. I need to implement a Euler path algorithm for sequence assembly from sequence by hybridization(SBH). Thus, the program needs to implement a FASTA file, a file that contains multiple letters(A,T,C,G), and needs to output an FASTA file wit...
...plants, this job is for you. The client intends to provide the successful candidate with partially molecularly characterized events as dry leaves. The partner must be able to provide the following deliverables: Flanking sequence recovery (FSR) for both borders at the same time; FSR rate above 80% of at least one border; FSR capability to handle 100-200 events at one time; Majority of the recovered flanking sequences should be in the range of 250bp to 1000bp, with minimum of 150bp required. Delivery of FSR reports within 4 to 6 weeks after receipt of plant materials, including the following details: Accurate flanking sequence and its adjunction insert sequence in the same orientation as the border sequence client provides; FASTA seque...
...English to Spanish. The text is about a computer program for biology. To win the bid you need: * Excelent english skills * NATIVE spanish skills Estimated time to finish the translation: below 30 minutes. ## Deliverables The text to be translated is below. It can also be found here: Please copy/paste the above page in Word in order to keep the page layout similar. IMPORTANT: The text contains some advanced biology/software related terms. Do not bid if you don't understand them. The translation needs to be of maximum accuracy. The translation will be checked by a secondary translator. The Spanish language needs to be official Spanish (Spain) and not dialects specific to a country/region. De...
We need someone to write a java web start application that will transfer genomics data into the Amazon cloud. ## Deliverables We need someone to write a java web start application that will transfer genomics data into the Amazon cloud. This project is expected to take approximately 2 weeks of time to complete. It needs to use the java security library to encrypt data, and then transfer that data securely to an Amazon elastic compute cloud S3 data stores using a minimal GUI. The files to be uploaded in this way will be very large fastQ files. Such files need to be split correctly (so that the individual records are not separated) into 4GB chuncks and then uploaded to an S3 bucket on the cloud. This application a...
...would like to serve over the web. The application is currently run on the command line via a perl script that is able to process multiple files with different options and spits out R code to generate postscript graphs using the dotplot files. Input is two DNA sequences, 4 options (flags) and the output is two text files: a dotplot file (for graphing the alignment) and an alignment file (showing where the two sequences match). I want to serve this app over the web using the standard CGI/PERL paradigm. The challenge is to make the graphs dynamic such that after mouse-over a feature on the graph will show the corresponding region in the alignment text file (or something similar). Clever perl scripting could be used to generate an html image ma...
Program that searches PCR primers in a given dna sequence in Python in the 5' - 3' strand and the reverse complement strand No need for GUI programs searches and gives the first hit as output for each strand Primer is a piece of dna that has: Length of 17 to 30 bases GC-content about 50-60% (if possible) The 3' end should have a G or C as the end base Tm (melting temperature) between 55 and 65 ºC Tm = 2ºC(A+T) + 4ºC (C+G) (A, T, C, G - number of respective bases) Input: Fasta file, or copy paste DNA sequence output program: Sequence primer 1 from 5' - 3': Sequence primer 2 from 5' - 3':
I need to proofread for best practice and optimize for speed, a bioinformatics script in perl/bioperl. And to write a CPAN script for installation on linux server. To use this script you will need: * Bioperl (L<http://www.bioperl.org/>) modules, * HMMER distribution (L<http://hmmer.janelia.org/>) and * FASTA distribution (L<ftp://ftp.ebi.ac.uk/pub/software/unix/fasta/>).
... Project Description The aim of the project is to develop a graphical version of the MUSCLE software that is easier for biologists to use. In addition, I would also like to incorporate some new functionality to make it easier to import and export data. Project Requirements • A graphical Window version of MUSCLE. • An ability to display the resulting data output. The MUSCLE software can export the resulting data alignment in html so this should be straightforward. • A new function allowing sets of data files not in FASTA format to be imported. This should be fairly simple as it will only involve reading in sets of text files and concatenating them together. • An export function that will allow the resulting f...
... Project Description The aim of the project is to develop a graphical version of the MUSCLE software that is easier for biologists to use. In addition, I would also like to incorporate some new functionality to make it easier to import and export data. Project Requirements • A graphical Window version of MUSCLE. • An ability to display the resulting data output. The MUSCLE software can export the resulting data alignment in html so this should be straightforward. • A new function allowing sets of data files not in FASTA format to be imported. This should be fairly simple as it will only involve reading in sets of text files and concatenating them together. • An export function that will allow the resulting f...
Vi behöver översätta fasta meningar från engelska till grekiska eller svenska till grekiska. Dessa meningar innehåller variabler som byts ut vid publicering med text som är enhetlig för alla språk såsom, siffror, för och efternamn, städer, arenor etc.
Jag vill göra en till tre "räknesnurror" på min webbsida där man matar in vissa fakta och får ut en annan. Detta ska användas för manuella terapeuter som vill räkna ut en dosering när de ska behandla med sitt laserinstrument. Parametrarna är djup i cm (fasta val 0 cm, 1-2 cm, 3-4, cm, 5-6 cm), tid i sek, uteffekt i W (kan vara vilken som helst) och Joule (dosering - kan vara vad som helst). Varför jag skriver en till tre räknesnurror är för att olika ljus (våglängder= nm) kräver olika hög dos så som rubrik för varje snurra bör det finnas med om de har laser med våglängder 780-860 nm, superpulsade runt 904 nm eller ca 650-670 nm. Om du nu inte har n&ar...
Les fichiers contenant des séquences protéiques ou nucléotidiques sont la plupart du temps au format “fasta”. Le format fasta est assez simple puisque ce sont des fichiers textes qui contiennent une ou plusieurs séquences. Pour chaque séquence il y a une ligne avec un identifiant unique, dont le début de ligne commence par un ”>” (il y a aussi éventuellement quelques mots de descriptions, ). La ligne qui suit est la séquence elle-même, correspondant à l'identifiant mentionné avant. Cette séquence peut être sur une ou plusieurs lignes. Puis à nouveau un identifiant et ainsi de suite. Une séquence protéique est représentée p...
organisera bilder tagna med telefon eller Ipad, under fasta kategorier. När man tagit bilden kommer flikar med kategorier upp, då väljer man en och bilden flyttas till den fliken.
